Laboratory notes

1 DNA extraction *

Introduction *

GeneCatcher^™ Technology from DNA Research Innovations Ltd. *

Description *

Why is there a need for a new technology? *

What are the advantages of GeneCatcher™? *

Protocol *

Sample Preparation *

DNA Capture *

This step washes away residual contaminants *

DNA Purification *

DNA Elution *

2 Genotyping; theories and practicalities. *

Aims: *

1. What is Genotyping? *

2. How does this differ from Mutation Detection? *

3. What is a Microsatellite? *

4. What is a SNP? *

5. Why are SNP’s Important? *

6. How are these variations detected? *

7. Genotyping via microsatellite markers: *

ARMS-PCR *

Minisequencing *

Melting Curve analysis: *

OLA/PCR *

How to decide what method to use and when to use it? *

3 Polymerase chain reaction and ARMS *

PCR *

Reagents *

Primers *

PCR buffer *

dNTPs *

Thermostable polymerases *

Equipment *

PCR Machines (Thermal Cyclers) *

Hot start PCR protocol using heat-activated polymerase *

ARMS *

Principle *

Materials *

Agarose Gel Electrophoresis: *

Interpretation of Results *

References *

4 Oligonucleotide ligation assay (OLA) *

Introduction *

Overview of the Assay *

5 Liquid phase arrays: EraGen MultiCodeÒ PLx Platform Technology *

Technology for the Detection of Genomic DNA Mutations *

Workshop Outline *

Background *

Overview of Technology to be presented: *

6 DHPLC *

DHPLC practical session *

Overview of the design and execution of a mutation detection project by DHPLC. *

Background *

Theoretical predictions of melting temperature. *

Sample Preparation for DHPLC *

Sample quality *

Sample quantity *

PCR considerations *

Heteroduplex formation *

Tumour samples *

Interpretation of DHPLC data *

Identification of mutations. *

DHPLC system configuration *

Other practical considerations for DHPLC *

Troubleshooting guide *

References *

COSHH Assessment *

Control measures *

Emergency procedures *

7 Sequenom Mass Array *

Introduction *

Homogeneous MassCLEAVETM *

Forward Reactions *

Reverse Reactions *

Summary *

References *

9 Automated Fluorescent DNA Sequencing *

Applications *

Equipment and reagents *

Protocol *

A). PCR purification *

Sequencing reaction *

C) Ethanol clean up of sequencing reactions in microtitre 96 well plates *

D) Preparation of samples for 3100 run *

Additional notes: *

PCR Purification *

Analysis of results *

10 Single Strand Conformation Polymorphism (SSCP) *

Advantages of SSCP *

Limitations of SSCP *

Protocol 1 : manual SSCP *

Outline protocol for manual SSCP *

Protocol 2: fluorescent SSCP *

Advantages of FSSCP *

The critical points for setting up FSSCP. *

11 TaqMan *

The 5’ nuclease assay: Genotyping using Taqman technology. *

Aims: *

1.What is Taqman? *

2. How does the nuclease reaction work? *

3. How can it be used for Genotyping *

4. Using the taqman assay within the lab: *

The family of equipment and what it can do: *

5. Practical considerations: *

Typical taqman scatter plots: *

References: *

Introduction *

Methd *

BRCA1 and BRCA2 DGGE *

Amplification *

Making Gradient gels. *

References *

14 Multiplex Ligation-dependent Probe Amplification (MLPA) *

Introduction *

Applications *

Reagents *

Controls *

Other Equipment/Solutions Required *

Thermocycler programme *

Protocol *

DNA-Denaturation and Hybridisation of the SALSA probes: *

Ligation reaction: *

PCR *

Separation of amplification products *

For analysis on ABI 3100 or Avant using FAM labelled MLPA kits: *

Relative quantification of amplification products *

Automatic analysis using Genotyper macros *

Dosage quotient calculation using Excel templates *

Additional Notes *

Deletions & Duplications *

Artefacts *

Reduced peak heights with increasing amplimer size *

Hybridisation problems *

References *

15 Pyro-sequencing *

Introduction *

Method *

Automatic genotyping *

17 Whole genome amplification *

Introduction *

Amersham GenomiPhi DNA Amplification Kit *

Introduction *

Reagents *

Equipment *

Components of the kits *

Safety warnings and precautions *

Protocols *

Overview *

Performing a GenomiPhi DNA amplification *

Transfer starting material into Sample Buffer *

Purified DNA *

Denature the sample *

Prepare the GenomiPhi premix *

Use in downstream experiments *

Troubleshooting *

No amplification *

References *

18 Array (Affymetrix 10K Gene chip) *

Introduction *

SNP Mapping *

References *

19 High-resolution Thermal Denaturation Chemistry; applications to mutation scanning and site-specific genotyping *

Goals of the Workshop *

Format of Workshop *

Introduction to melting analysis as a tool to assess amplification products. *

High-resolution melting to assess a PCR product for sequence variation *

Analyzing melt profile data. *

Specific Issues in Gene Analysis *

Introduction to Dye-binding/High-resolution thermal denaturation and melting as a tool to assess a PCR product *

References *

20 Mutation Surveyor *

SoftGenetics Technologies and methods used in Mutation Surveyor and Explorer: *

Point Mutation Detection: *

Indel Detection: *

Advantages of SoftGenetics physical trace comparison technology: *

Mutation parameters and mutation scores *

References *

21 Sequence analysis using the Staden package *

INTRODUCTION *

BACKGROUND INFORMATION *

PREGAP4 – A BRIEF TOUR *

About File Naming & Naming schemes *

GAP4 – A BRIEF TOUR *

HUGO STADEN WORKSHOP PRACTICAL EXERCISES *

EXERCISE 1: Create a blank reference sequence database using Pregap4 *

EXERCISE 2: Add patient sequence files to a reference sequence database and carry out automated mutation analysis. *

EXERCISE 3: Open a Gap4 database and analyse sequences for mutations *

EXERCISE 4: Removing and replacing readings from assembled databases *

EXERCISE 5: Annotating and editing a blank database with Tags *

APPENDIX 1: BRIEF OPERATING INSTRUCTIONS FOR STADENv2003.0b1 *

ASSEMBLING YOUR FILES USING PREGAP4 *

VIEWING YOUR FILES WITH GAP4 *

Opening the Contig Selector *

APPENDIX 2: AVOIDING PROBLEMS *

COMMON PROBLEMS *

APPENDIX 3: ARCHIVING STADEN DATA *

APPENDIX 4: CONFIGURATION STEPS FOR STADEN PACKAGE v2003.0b1 *

A: Installation of the Staden Package *

REMOVING MODULES *

C: Gap4 Configuration *

D) Display settings *

1 DNA extraction

Introduction

The notes from previous HUGO courses cover conventional extraction methods, and are not repeated here. Recently there have been developments in automating DNA extraction and I using alternative technologies based around mixed phase separations. This demonstration introduces an magenetic bead-based methos that we have found to work well in the laboratory.

GeneCatcher^™ Technology from DNA Research Innovations Ltd.

A new technology for purifying genomic DNA from large volumes of blood (0.5-10 ml)

Concentrated DNA eluted in a small volume for storage or downstream processing

Scalable for manual or automated processing


Manual processing of large blood volumes using *GeneCatcher™*	GeneCatcher™ can also be automated on standard liquid handling workstations such as the Tecan Freedom EVO™

Description

GeneCatcher™ is a new proprietary technology for DNA extraction from large volume blood samples. Using GeneCatcher™ kits, concentrated DNA is eluted in a small volume optimal for storage or downstream processing. GeneCatcher™ utilizes a small number of magnetic beads to capture genomic DNA from whole blood, without the need for centrifugation. It is fully scalable and can flexibly deal with a range of different sample types and volumes. It is easy to automate on standard liquid handling workstations, offering researchers a cost-effective and reliable method for extracting high quality, high concentration DNA.

Why is there a need for a new technology?

Following the complete sequencing of the human genome, we are now entering what has been dubbed as the "post-genomic era". There is now an increasing focus in clinical research on comparing the genomes of large numbers of individuals, in order to understand the causes and improve the diagnosis and treatment of disease. This involves large-scale genotyping and bio-banking projects and is behind the now urgent need for a cost-effective, user-friendly chemistry for the extraction of genomic DNA from large volumes of blood. GeneCatcher™ addresses this new demand directly.

What are the advantages of GeneCatcher™?

Practical

High yields of pure DNA can be extracted in a simple cost-effective manner and DNA is eluted in a small volume and high concentration that is optimal for storage or for further processing.

Scalable

Samples of blood for genomic DNA extraction can vary dramatically in volume, from as little as a few hundred microlitres up to as much as ten millilitres. The GeneCatcher™ range of kits can be flexibly applied to a full range of sample volumes.

Flexible

Blood samples are stored in the presence of a variety of anticoagulants and may be old and heavily degraded from repeated freezing and thawing. GeneCatcher™ is capable of dealing with the most challenging of samples. It is not reliant on intact cells and does not require centrifugation for extraction, making it ideal for degraded and archived samples. It reliably produces high quality purified DNA, with anticoagulants, such as EDTA, heparin and ACT, having no effect on its extraction efficiency.

Easy to automate

High throughput genotyping projects usually involve automated processes using liquid handling workstations. GeneCatcher™ kits do not require any centrifugation and can be carried out in a single reaction tube, making them ideal for automation.

Cost-effective

Large-scale projects demand cost-effective methods. GeneCatcher™ only requires a small number of magnetic beads and uses a simple process, making it extremely cost-effective.

Reliable

In large-scale projects, reliable extraction from a range of different sample types, which may also vary in quality, is key. GeneCatcher™ reliably extracts high levels of pure DNA at a high concentration in a small volume of buffer, making it ideal for large scale and high throughput applications.

Protocol

Before each run

Fully resuspend the GeneCatcher™ Magnetic Beads by thorough vortexing

Vortexing ensures an even distribution of GeneCatcher™ Magnetic Beads throughout the storage buffer

Set water bath to 65°C

Before commencing refer to the table in the protocol to choose the appropriate volumes of individual reagents to use in your GeneCatcher™ DNA extraction

Sample Preparation

The following protocol uses the recommended reagent volumes for a GeneCatcher™ extraction from 10 ml of human blood. For scaling the protocol for other volumes, please contact DRI.

DNA Capture

Add 150 µl of resuspended GeneCatcher™ Magnetic Beads into a 50 ml tube

Add 30 ml of Lysis Buffer

Swirl the tube gently

This ensures that the beads are homogeneously distributed throughout the buffer

Add 10 ml of well-mixed blood and cap the tube

Gently mix by inverting the tube 3 times

Incubate at room temperature for 5 minutes, periodically inverting to mix

Place the tube on the magnetic separator and leave for 3 minutes

Without disturbing the bead pellet, carefully remove the supernatant using a 5 ml pipette

Leave the tube on the magnetic separator during this step. Take care not to disturb the bead pellet, by slowly drawing off the supernatant from the opposite side of the tube. It is acceptable to leave behind a small amount of supernatant (up to about 2 ml) at this stage if the pellet should show signs of dislodging. Loss of any pellet at this stage would result in reduced yield at the end of the protocol

Remove the tube from the magnetic separator and add 5 ml of Lysis Buffer

This step washes away residual contaminants

Gently mix by inverting the tube for 5-10 seconds

Incubate at room temperature for 30 seconds

Place the tube back on the magnetic separator for 20 seconds

Remove the supernatant as in step 11

Take care not to dislodge the pellet of DNA and beads

DNA Purification

Remove the tube from the magnetic separator

Add 5 ml of Digestion Buffer and 40 µl of Protease

Replace the cap and vortex the tube until the bead pellet has been fully dispersed

Bead dispersal should take approximately 20 seconds. Complete bead dispersal may be difficult to achieve. Very small tendrils or clumps of beads may still be visible to the naked eye in solution. This is in an indicator of a high yield of DNA and will not affect further processing

Incubate at 65°C for 10 minutes

If there are visible signs of the bead pellet remaining, briefly vortex again until fully homogeneous

Allow the digest to cool fully to room temperature (5-10 minutes)

Add 5 ml of 100% IPA

Mix by inverting the tube until a visible aggregate has formed

Absence of an aggregate in the tube after 2-3 minutes is indicative of very low levels of DNA in the sample

Place the tube on the magnetic separator for 30 seconds

Remove the supernatant using a 5 ml pipette

Leave the tube on the magnetic separator during this step

Remove the tube from the magnetic separator

Add 3 ml of 50% (v/v) Aqueous IPA

Mix by inverting the tube for 20 seconds

Place the tube on the magnetic separator for 20 seconds

Remove the 50% IPA completely with a 5 ml pipette

Leave the tube on the magnetic separator during this step

Leave the tube for 1 minute to allow any remaining 50% IPA to drain. Remove any liquid with a 1 ml pipette

Leave the tube on the magnetic separator during this step. At this stage, ensure the inside of the top of the tube and the cap are clean and free of visible signs of residual blood/haem. If present, remove by wiping with a clean tissue

Pipette 250 µl of Aqueous Wash Solution over the DNA pellet

The Aqueous Wash Solution should be pipetted gently so it does not disperse the bead pellet

Incubate at room temperature for 1 minute

This will allow the Aqueous Wash Solution to completely drain to the bottom of the tube

Remove the Aqueous Wash Solution with a 1 ml pipette

Leave the tube on the magnetic separator during this step

Repeat steps 32-34

Leave the tube on the magnetic separator during these steps. Ensure all visible signs of liquid have been removed from the bottom of the tube

DNA Elution

Remove the tube from the magnetic separator

Add 1 ml of Elution Buffer

Swirl the tube gently

Ensure the whole bead pellet is released from the wall of the tube into the buffer

Incubate at 65°C for 1 hour

Remove from the water bath and gently swirl the tube until the bead pellet has been completely resuspended

If the bead pellet has not fully dispersed at this point, very gentle tip-mixing with a 1 ml pipette should complete the process. For samples with pellets that are very difficult to resuspend (i.e. high level of DNA) - place the tube back into the 65°C water bath for a further 15 minutes, followed by a further gentle tip-mix. If the Elution Buffer appears too viscous it can be diluted by adding extra Elution Buffer

Place the tube on the magnetic separator until the supernatant appears totally clear and colourless by eye 15-30 minutes depending on viscosity. Viscosity is related to DNA concentration

Remove the supernatant, containing the DNA, using a 1 ml pipette and transfer to a clean 2 ml tube

Do not disturb the pellet at this step

2 Genotyping; theories and practicalities.

Aims:

To introduce Genotyping in general.

To discuss the some of underlying methods involved.

To discuss some of the specific methods commonly used.

To help plan a genotyping project, in particular what method to use.

1. What is Genotyping?

Genotyping is the determination of known variations within a given population, whether that population be human, mouse, rat, drosophila etc. Genotyping can be carried out by looking at 2 different forms of variation: microsatellites or Single Nucleotide Polymorphisms (SNPs).

2. How does this differ from Mutation Detection?

Mutation Detection is the search for DNA sequence variants (base substitutions, small indels) in defined regions of DNA where there is no prior knowledge of the variant.

3. What is a Microsatellite?

A microsatellite (marker) is a region of repeat DNA, these repeats can by Di- (2), Tri-(3) or Tetra- (4) nucleotides units and it is the number of these units which can vary between individuals. These markers are usually found in intervening (non-coding) sequences of DNA.

For example:

4. What is a SNP?

A SNP is a type of polymorphism that occurs when a single nucleotide is altered and such variations are found in coding and non-coding regions of DNA. The presence of a SNP could alter the DNA sequence as follows: AAGGCTAA to ATGGCTAA

SNPs make up about 90% of all human genetic variation and occur every 100 to 300 bases along the 3-billion-base human genome. Since SNPs are present within the coding sequences they can also be classed as synonymous, resulting in no amino acid change or Non-synonymous, resulting in a change in the amino acid sequence and hence producing a variation in the protein.

5. Why are SNP’s Important?

SNPs are important because they make better markers for complex diseases and Pharmacogenomics (The study of the interaction of an individual's genetic makeup and response to a drug).

The reason why they make better genetic markers is 2 fold:

Firstly it is due to their high density and more even distribution throughout the genome, a true SNP will have an allele frequency of at least 1%.

Secondly it is due to the fact that the SNP’s can be found in coding as well as non-coding sequence.

This allows the linkage to be carried out within gene sequences
And there is also the potential to see gene function changes associated with a specific SNP.

6. How are these variations detected?

There are a whole plethora of methods for detecting genotypic variations, you just have to look on PubMed to see this (Kwok) and companies and research labs are devising new methods all the time.

7. Genotyping via microsatellite markers:

With respect to Microsatellites there is only one way they can be used for genotyping. Each marker has to be amplified using fluorescently labelled primers.

The PCR products are then separated via size differences using electrophoretic separation on an ABI machine of some description (ABI 373, 377 slab gels, 310, 3100, 3700 and 3730 capillary electrophoresis).

Schematic representation of Capillary Electrophoresis

The markers are organised into ‘panels’ and these panels consist of groups of PCR products that are separated on a size/colour base, see table below

The genotypes are then determined from the electropherograms that are produced:

(Notice the overlap in size on different colours). The image below shows 1 sample with a number of different markers.

8. SNP Genotyping:

Unlike microsatelite genotyping there is a huge range of different techniques available to genotype SNPs, for instance:

ARMS-PCR (Amplified Refractory Mutation System-PCR)
DASH (Dynamic Allele Specific Hybridisation: ThermoHybaid)
MLPA (Multiplex Ligation-dependent Probe Amplification)
McSNP (ThermoHybaid)
Pyrosequencing
RFLP (restriction Fragment Length Polymorphism)
Sequenom (sequenom)
SNaPshot (ABI)
SNPlex (ABI)
Taqman (ABI)
tetra nucleotide primer
SNP Chips
VariantSEQr

However all of the systems mentioned rely on a few basic underlying techniques:

PCR ie ARMS-PCR
Restriction digest ie RFLP
Ligation ie MLPA and OLA/PCR
Allele Specific Hybridisation ie DASH
Melting curve analysis ie McSNP
Mini Sequencing ie Pyrosquencing and VariantSEQr
Primer Extension ie SnaPshot and sequenom

Allele Specific Hybridisation

Sytems including

•DASH

–Detection of a PCR product via Hybridisation of an Allele specific probe in combination with Sybr green detection

Schematic representation of DASH.

ARMS-PCR

–Use Allele specific PCR primers to determine allele. Allele determination therefore requires 2 PCR reactions (one for each allele) or a multiplexed reaction.

Schematic representation of ARMS-PCR

– Allele determination can be via agarose gel electrophoresis, via the use of Fluorescently labelled primers (as illustrated earlier) or in combination with Sybr green detection (Alkaline Mediated Differential Interaction (AMDI)).

Schematic representation of AMDI.

Minisequencing

Systems including

•Pyrosequencing

•Solid phase minisequencing

Schematic representation of Mini-sequencing (Pyrosequencing).

Therefore using mini-sequencing the user is able to directly see which allele is present.

Melting Curve analysis:

–Systems including

McSNP

RFLP based system combined with Sybr Green detection. Assign genotype from difference in melting curves between cut and uncut alleles

•Tm-Shift Genotyping

Combines allele specific PCR with melting curve analysis.

Schematic representation of Melting Curve analysis ( McSNP).

OLA/PCR

Systems including:

•SNPlex (applied Biosystems)

•MLPA

Probe design can be complicated, so I will only briefy touch on this method due to time constraints

Primer extension

Systems including

•SNaPshot (applied Biosystems)

•Sequenom:

•MALDI-TOF

–Extend an Internal primer by a single, Fluorescently labelled ddNTP

Schematic representation of SnaPshot (ABI)

RFLP

Use the loss/gain of a restriction site in order to type the allele

–Agarose gel based; can use fluorescently labelled primers and then use and ABI machine to detect digest products

–Time consuming and sometimes difficult to interpret results

Schematic representation of RFLP analysis

F-RFLP eletropherograms:

How to decide what method to use and when to use it?

The decision on the genotyping method is always a compromise between equipment cost/availability, costs per sample, ease of protocol and accuracy of results:

The decision on what method to use is usually the easier of the two questions to answer. It is likely that you will find that certain methods will not work:

ie RFLP: your SNP does not make or remove a restriction site

or you do not have access to the equipment needed and therefore some methods cannot be considered

ie taqman or sequenom.

Other issues which might prevent you from using a method even though the equipment is available is the sequence context of you variation, for example taqman is not very good if you have 2 adjacent SNPs ie aagcRYgcta, or the cost per genotype might be prohibitive.

However what happens if you have access to the equipment and the funds are available, when do you choose to use a given technique?

Here are some questions that need to be answered before picking a method:

How much money is available?
How much money do you want to commit to a single project?
What equipment is available?
How many samples will you be genotyping?
How many SNPs will you be studying?

Scenario 1:

You only have access to agarose gels or an ABI377.

You want to look at 500 people and 5 SNPs.

Funding is OK, but it will be from general lab grants

What would you choose? Obviously the equipment available immediately limits you to some extent. Perhaps you look at using RFLP, but not all SNPs make/break a restriction site, so now you are looking to use ARMS-PCR.

For ARMS-PCR you will have to do 2 PCR’s per allele making that 5000 samples:

What must you consider for an ARMS-PCR project:

Ease: Not to difficult once the PCR’s are optimised, but can be time consuming (need known samples to work on).

Size of the project: 2500 samples 5 SNPs, so it isn’t very big.

Money: How much money can you spare from the overall lab budget?

Speed: Again not too bad once optimised, but the overall speed of the project could be increased by labelling the PCR primers and using the ABI377 or by multiplexing the PCRs.

Accuracy: Gel based analysis will always result in some problems. Firstly it will become a bottleneck for your workflow and secondly there will be times when you cannot genotype some reactions.

Sequence 1: FAM-TGGGCTGCACGCTACC

Sequence 2: HEX-TGGGCTGCACGCTACT

Sequence 3: CTCACCTGGTCGAAGCAGTAT

OUTCOME:

The easiest way to do this would be to fluorescently label you primers and then use the higher sensitivity and throughput and associated software of the ABI377 to carry out your genotyping

Scenario 2:

You have access to an Agarose gels an ABI377 or ABI7900 (for taqman assays)

You are looking at 3000 people and 25 SNPs

The funding is specifically for this project

Ease: Taqman assays should come ready to go, otherwise you would have to optimise 50 PCR ‘s

Size of the project: 5000 samples 25 SNPs, so it is quite big, size would double for ARMS-PCR

Money: Money is specifically to do this work, but Taqman would be costly!

Speed: taqman would be very fast, usual bottlenecks for ARMS-PCR.

Accuracy: With or without auto calling Taqman will be very accurate, but could be some issues with very rare SNPs! Always issues with gel based genotyping this would improve on the 377.

OUTCOME:

For this scale, equipment availability and with this kind of funding I would look to use the ABI7900, because of the throughput, ease of protocol and because of the support available from ABI in terms of assay design, troubleshooting and equipment maintenance.

Flow Chart showing the major considerations when choosing a genotyping method.

References:

Akey JM, Sosnoski D, Parra E, Dios S, Hiester K, Su B, Bonilla C, Jin L, Shriver MD. Melting curve analysis of SNPs (McSNP): a gel-free and inexpensive approach for SNP genotyping. Biotechniques. 2001 Feb;30(2):358-62, 364, 366-7.
Dearlove AM. High throughput genotyping technologies. Brief Funct Genomic Proteomic. 2002 Jul;1(2):139-50.
Eggerding FA. A one-step coupled amplification and oligonucleotide ligation procedure for multiplex genetic typing. PCR Methods Appl. 1995 Jun;4(6):337-45.
Elahi E, Ronaghi M. Pyrosequencing: a tool for DNA sequencing analysis. Methods Mol Biol. 2004;255:211-9.
Holland PM et al. Proceedings of the National Academy of Sciences. 88:7276-7280. 1991
Holland PM et al. Clinical Chemistry. 38:462-463. 1992
Jobs M, Howell WM, Stromqvist L, Mayr T, Brookes AJ. DASH-2: flexible, low-cost, and high-throughput SNP genotyping by dynamic allele-specific hybridization on membrane arrays. Genome Res. 2003 May;13(5):916-24
Kwok PY, Chen X. Detection of single nucleotide polymorphisms. Curr Issues Mol Biol. 2003 Apr;5(2):43-60.
Lai CH, Welter MW, Welter LM. The use of arms PCR and RFLP analysis in identifying genetic profiles of virulent, attenuated or vaccine strains of TGEV and PRCV. Adv Exp Med Biol. 1995;380:243-50
Lee LG, Connell CR and Bloch W. Nucleic Acids Research.21:3761-3766. 1993
Punia P, Cane P, Teo CG, Saunders N. Quantitation of hepatitis B lamivudine resistant mutants by real-time amplification refractory mutation system PCR. J Hepatol. 2004 Jun;40(6):986-92.
Romppanen EL. Oligonucleotide ligation assay: applications to molecular diagnosis of inherited disorders. Scand J Clin Lab Invest. 2001 Apr;61(2):123-9.
Sellner LN, Taylor GR. MLPA and MAPH: new techniques for detection of gene deletions. Hum Mutat. 2004 May; 23(5):413-9.
Ye S, Dhillon S, Ke X, Collins AR, Day IN. An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res. 2001 Sep 1;29(17):E88-8

3 Polymerase chain reaction and ARMS

GR Taylor

PCR

The polymerase chain reaction (PCR) is an in vitro technique for the synthesis of specific sequences of DNA (including cDNA) using DNA polymerase. The specificity of the reaction is due to the requirement of all DNA polymerases for a double stranded start site for de novo synthesis . Two primers are used, which flank the region to be amplified. The primers are themselves incorporated into the reaction product. Primer sequences for targets of interest are recorded in the relevant sections of this manual and in the primers database. The reaction works by denaturing genomic or cDNA (or single stranded DNA can be used) in the presence of excess (5-50pmol/reaction) primers, dNTPs, buffer and heat stable Taq polymerase. The mixture is cooled, to allow primer hybridisation and incubated to allow polymerisation of new strands. An almost exponential synthesis of DNA should result, producing ng-mg amounts after 25-35 cycles. This can then be analysed on gels directly after restriction digestion. It is standard practice in this laboratory to conduct hot start PCR. This means that active reagents are only combined at high temperature and tends to increase the yield and specificity of the reaction. Hot start can be achieved by either physical separation of the reagents, e.g. using a wax barrier or a two stage set-up, or by using enzyme formulations such as Clonetech Advantage, Platinum Taq or AmpliTaq Gold that are modified to require heat activation before use. In the case of AmpliTaq Gold 10-15 minute pre-heating at 95^oC is required in the initial denaturation step.

PCR products should be analysed by gel electrophoresis. Greater than 80% of the product should be as fragments of the expected size. The amplification reaction is conducted using an automated thermal cycler. Products are detected either by staining using ethidium bromide or silver, by radioactive labelling or by fluorescent labelling.

Reagents

Taq buffer is often supplied with the enzyme, but some Taq enzymes are not compatible with buffers from other manufacturers. This is probably because of the detergents used. AmpliTaq Gold will not be activated in high ammonium salt buffers and should only be used in the buffer supplied. Because salt and magnesium ion concentrations vary in different buffers, annealing temperatures and PCR yields may need to be re-optimised if a buffer is changed.

Primers

Primers are routinely stored at -20^oC in 50% glycerol/TE at 100µM. These are used to make up working stocks.

PCR buffer

Tris/Cl pH 8.4 10mM

KCl 50mM

MgCl21.5mM

dNTPs 200mM

triton X-100 0.1%

BSA 0.01% (not essential)

dNTPs

These are obtained as ultra pure, neutralised solutions (100mM) from Amersham-Pharmacia, Promega or Roche).

dNTP solution 100x (20mM) working stock

50ml of each dNTP 50ml water. Store at -20oC.

Thermostable polymerases

The polymerases used for the PCR fall broadly into two categories: those with proofreading (3’-5’ exonuclease) activity and those without. Most PCR amplification use DNA polymerases that lack proofreading properties derrived from Thermus aquaticus or other thermophilic eubacteria. A wide range of suppliers manufacture suitable enzymes including Promega native Taq polymerase AmpliTaq Gold (Applied Biosystems) and Clonetech Advantage (Clonetech). Unit activities are measured as Kunitz units, reflecting ammount of labelled precursor that is incorported into acid-insoluble material and enzyme is typically supplied at 5 units per microlitre. Although this unit of measurement does not replect the processivity of the enzyme (number of bases synthesised per enzyme binding event), final concentrations of between 1/50 and 1/200 dilutions usually work well. Different buffer formulations may produce annealing temperatures that vary by 1 or 2ºC.

Equipment

PCR Machines (Thermal Cyclers)

There are several type of thermal cycler and temperature ramp-speed, accuracy and uniformity may vary between machines. The HUGO courses have used MJ Research Tetrads, and other machines including the Applied Biosystems 9700 are equally effective.

Hot start PCR protocol using heat-activated polymerase

Add DNA (5-250ng), primers (5-50pmoles) and enzyme/reagent mix to 10 microlitres. Always include negative control.

Cover with oil if not using a heated lid.

Place in thermal cycler, switch on and start up for the initial 5 minute denaturation step (15 minutes for AmpliTaq Gold).

Samples can be stored in the machine overnight.

Table 1 Stochiometry of the PCR (after Ruano G, Brash DE, Kidd KK, 1991 Amplifications (7) p1-4.)

Component of Reaction	Initial	After 106 fold amp.
Human DNA
Weight	1mg	1mg
moles	5x10-7pmole	5x10-7pmole
Conc	5fM	5fM
ratio to template	1:1	1:1

1kb target
Weight	0.3pg	0.3mg
moles	5x10-7pmole	0.5pmole
Conc	5fM	5nM
ratio to template	1:1	106:1

Primer
Weight	65ng	62ng
moles	10pmole	9.5pmole
Conc	0.1mM	0.095mM
ratio to template	2x107:1	2x107:1

Taq polymerase
Weight	0.1mg	0.1mg
moles	0.1pmole	0.1pmole
Conc	1nM	1nM
ratio to template	2x105:1	2x105:1

dNTP(each)
Weight	11.5mg	11.4mg
moles	2x104pmole	1.98x104pmole
Conc	200mM	198mM
ratio to template	4x1010:1	3.95x1010:1

This table is based on a 100mL reaction assuming genome=3.3x109bp,1bp=650 daltons, oligos as 20mers, 1base=325 daltons, no degradation due to thermal cycling, 1U Taq=50fmole of enzyme, 1dNTP=575 daltons. For equal G,C,A,T template, 103x2/4=500 pmole each dNTP is consumed for each 1kb product.

ARMS

This is a modification of conventional PCR in which one of the primer pairs is designed to have the polymorphic base in the template at its 3' position . Taq polymerase is unable to extend from a mismatched base, and so the generation of a PCR product only occurs if the 3' base in the primer matches the template. The technique can be multiplexed to type 20-30 SNPs simultaneously.

Principle

The method employed is based on the amplification refractory mutation system (ARMS). The principle is that an oligonucleotide with a mismatched 3’ residue will not function as a PCR primer. Primers are designed so that the 3’ base is at the site of a particular mutation, and amplification of this product only occurs in the presence (or absence) of this mutation.

The kit provided is for the simultaneous in vitro qualitative detection of Factor V Leiden (R506Q), Prothrombin (Factor II 20210A) and methylenetetrahydrofolate reductase (MTHFR C677T) mutations. The test can distinguish between individuals who are heterozygous and homozygous for all mutations.

Materials

Reagents supplied:

Storage of the reagents should be in an area free from contaminating DNA or PCR product.

All reagents are supplied ready for use. Store unopened and opened reagents at -20"C.

Opened reagents can be stored for up to 3 months.

Sufficient materials for 50 tests are provided:

2 vials Primer Mix A (TA) containing primers specific for amplification of alleles unaffected by the Factor V, Factor II or MTHFR mutations, control primers and deoxynucleotide triphosphates in buffer (2 x 450mL)

2 vials Primer Mix B (TB) containing primers specific for amplification of alleles affected by the Factor V, Factor II or MTHFR mutations, control primers and deoxynucleotide triphosphates in buffer (2 x 450mL).

1 vial x 200mL of CR000TV Dilution Buffer (DB).

1 vial x 600mL of CR000TR Loading Dye (LD).

1 vial x 50mL of TH003TX Control DNA (DC), normal for the factor V Leiden R506Q and prothrombin 20210A mutations and heterozygous for the MTHFR C677T mutation.

Controls:

A normal DNA control is also supplied (at a concentration of 5ng/ml).

We also have control DNA samples diluted ready for use.

Test DNA:

DNA extracted by routine method:

DNA is diluted to a concentration of 10ng/ml for use with the ARMS kit.

For most DNA samples (which are resuspended at a concentration of 500mg/ml) this is a 1/50 dilution.

The figures given in Tables 1 and 2 can be increased proportionately for numbers of tests other than those specified. However, owing to the small volumes involved, Tepnel Diagnostics recommends that no fewer than 5 tests are prepared at one time.

1. Program the thermal cycler for a time-delay file to activate the AmpliTaq Gold at 94"C for 20 minutes linked to an amplification cycling program of 30 seconds at 94"C (denaturation), 2 minute at 58"C (annealing) and 1 minute at 72"C (extension) for 35 cycles. This should be linked to a 20-minute time-delay file at 72"C (extension) on the final cycle.

2. Thaw and centrifuge the Primer Mix A (TA), Primer Mix B (TB), AmpliTaq Gold (not provided), Loading Dye (LD) and Dilution Buffer (DB) vials for 10 seconds at 12 000g, mix gently by vortexing and centrifuge the vials again for 10 seconds.

3. Referring to Table 1 prepare sufficient dilution of the AmpliTaq Gold in the Dilution Buffer and

Loading Dye supplied and sterile distilled water for the number of samples and controls to be

tested. Mix thoroughly by gently pipetting up and down.

Table 1. Dilution of AmpliTaq Gold

4. Referring to Table 2, prepare the A and B reaction mixes. Remove the appropriate aliquot of Primer Mix A into a labelled microfuge tube. Repeat with Primer Mix B into a second labelled microfuge tube. Using separate pipette tips add the appropriate volume of the AmpliTaq Gold dilution (from step 3) to each microfuge tube. Mix gently by vortexing and centrifuge the vials for 10 seconds at 12 000g.

Table 2. Preparation of A and B Reaction Mixes

5. Label one vial )A° and one vial )B° for each sample or if coloured vials are available use a different colour for each primer mix.

6. Pipette 20mL of the prepared A reaction mix into the bottom of each of the appropriate number of the PCR vials labelled )A. Repeat with the B reaction mix into each of the appropriate number of the PCR vials labelled)B.

7. Using separate pipette tips each time, add 5mL of test DNA sample into each of a vial A and B pair. Add one drop of Sigma light white mineral oil to cover the aqueous phase *. Re-cap firmly.

8. For the negative control add no DNA to a vial A and B pair. Add 1 drop of Sigma light white mineral oil to cover the aqueous phase *. Re-cap firmly.

9. Centrifuge the A and B vials for 10 seconds at 12 000g.

10.Place all vials firmly in the thermal cycler block. Initiate the 94"C time-delay file followed by the amplification cycling program.

11.Discard all the remaining unused AmpliTaq Gold dilution and prepared A and B reaction mixes.

12.On completion of the amplification cycling program, the samples may be stored at room temperature overnight or at 2-8"C for up to 7 days before analysis by gel electrophoresis.

* For amplification carried out in 0.5mL PCR vials or thermal cyclers without heated lids.

Agarose Gel Electrophoresis:

300ml of 3% Nusieve 3:1 agarose (6.7g nusieve GTG low melting point agarose, 2.3g normal agarose) is prepared in 1x TBE. This is boiled and poured (with 25-30mL of Ethidium Bromide) into a large gel tray with 2 combs, giving 40 wells.

Once set, cool the gel at 4^oC for 15-30 minutes.

All 10 mL of each PCR product is loaded with 1.5 mL agarose gel loading buffer.

A 50bp ladder (Pharmacia) is run in 4 lanes along side the PCR products. 2 mL of ladder is used per lane.

The gel is run in 1xTBE at 150V for 3-4 hours (the deep blue dye front (bromophenol blue) should be at the bottom of the gel).

The gels are visualized and photographed using the UV transilluminator.

The results can then be scored using a chart supplied in the instruction booklet.

Interpretation of Results

1. The negative control must show no bands within the area defined by the upper and lower control bands (see Figure 1).

2. The upper and lower control bands must be clearly visible in all samples (see Figure 1).

3. The position of the upper and lower control bands should indicate the correct molecular size (see Figure 1).

If any of the above points are not observed the results should not be interpreted and a repeat test carried out.

Figure 1 shows diagrammatically the size, in base pairs, and relative location of the PCR products in a gel that is expected for a heterozygous Thrombosis genotype (carrying the Factor V, Factor II or MTHFR mutations) using the Thrombosis Risk test reagent.

Figure 1

References

4 Oligonucleotide ligation assay (OLA)

The use of thermostable DNA ligase to perform genotyping was first described by Barany in 1991. The method described here combines PCR and OLA to genotype 31 pathogenic mutations in the gene ABCC7

Introduction

Cystic fibrosis (CF) is an inherited disorder that affects children and young adults. It is characterized by respiratory disease and pancreatic dysfunction (Welsh et al., 1995). Cystic fibrosis results from mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene (Welshet al., 1995). The CFTR gene was first found in 1989 (Keremet al., 1989; Riorden et al., 1989; Rommens et al., 1989), and since that time over 400mutations in the gene have been reported.

Overview of the Assay

The Cystic Fibrosis Assay screens samples for the presence of 31 mutations in the CFTR gene, including 24 of the most common mutations worldwide (Kazazian et al., 1994).

The Oligonucleotide Ligation Assay(OLA) utilizes probes and ligase to detect the presence of normal and mutant CFTR alleles. The ligated, fluorescent DNA fragments are separated and sorted based on their size and color.

During multiplex PCR, genomic DNA is amplified by Taq DNA Polymerase and 15 pairs of primers. These primers flank regions of the CFTR gene where common CFTR mutations may be detected. Each amplified region, or amplicon, is probed by three oligonucleotide probes. One of the probes, called the common probe, hybridizes to the amplicon at a sequence common to both the mutant and normal CFTR alleles. The common probe is labeled with one of three fluorescent dye tags, FAM, TET, or HEX.

The mutant probe and the normal probe are both allelic probes. These

two probes compete for binding to the PCR amplicon. The probe that is

the perfect complement to the CFTR amplicon will hybridize or bind to

the DNA and be ligated to the common probe (figure 1). The normal and mutant probes are derivitized with varying numbers of non-nucleotide mobility modifying tails, which are composed of pentaethyleneoxide (PEO)

units. If no mutations are present at a specific CFTR locus, the normal probe and the common probe will bind to that allele. If a homozygous mutation is present at a specific CFTR locus, the mutant probe and the common probe will bind to the sample DNA. In the presence of heterozygous DNA, the normal and mutant allelic probes and the common probe will bind at the respective normal and mutant loci.

The rTth DNA ligase facilitates the ligation of probes that are perfect complements of the CFTR amplicon. The rTth DNA ligase ligates the PEO modified normal or mutant probe to the dye-labeled common probe. When the two are ligated, an oligonucleotide ligation assay (OLA) product is formed. Each OLA product features a unique combination of electrophoretic mobility and fluorescence which permits identification of the CFTR genotype.

Figure 1-1 The Oligonucleotide Ligation Assay (OLA)

CFTR Mutations Screened

Mutation	Location	Nucleotide	Predicted Effect
∆F508	Exon 10	3-bp deletion	Deletion of Phe-508
∆I507	Exon 10	3-bp deletion	Deletion of Ile-507 or -506
Q493X	Exon 10	C-1609➝T	Gln-493➝Stop
V520F	Exon 10	G-1690➝T	Val-520➝Phe
1717–1G➝A	Intron 10	G-1717–1➝A	3´-Splice site mutation
G542X	Exon 11	G-1756➝T	Gly-542➝Stop
G551D	Exon 11	G-1784➝A	Gly-551➝Asp
R553X	Exon 11	C-1789➝T	Arg-553➝Stop
R560T	Exon 11	G-1811➝C	Arg-560➝Thr
S549R	Exon 11	T-1779➝G	Ser-549➝Arg
S549N	Exon 11	G-1778➝A	Ser-549➝Asn
3849 + 10kbC➝T	Intron 19	C-3849 + 10kb➝T	Splice mutation
3849 + 4A➝G	Intron 19	A-3849 + 4➝G	Splice mutation
R1162X	Exon 19	C-3616➝T	Arg-1162➝Stop
3659delC	Exon 19	1-bp deletion	Frameshift
W1282X	Exon 20	G-3978➝A	Trp-1282➝Stop
3905insT	Exon 20	1-bp insertion	Frameshift
N1303K	Exon 21	C-4041➝G	Asn-1303➝Lys
G85E	Exon 3	G-386➝A	Gly-85➝Glu
621 + 1G➝T	Intron 4	G-621 + 1➝T	5´-Splice site mutation
R117H	Exon 4	G-482➝A	Arg-117➝His
Y122X	Exon 4	T-498➝A	Tyr-122➝Stop
711 + 1G➝T	Intron 5	G-711 + 1➝T	5´-Splice site mutation
1078delT	Exon 7	1-bp deletion	Frameshift
R347P	Exon 7	G-1172➝C	Arg-347➝Pro
R347H	Exon 7	G-1172➝A	Arg-347➝His
R334W	Exon 7	C-1132➝T	Arg-334➝Trp
A455E	Exon 9	C-1496➝A	Ala-455➝Glu
1898 + 1G➝A	Intron 12	G-1898 + 1➝A	5´-Splice mutation
2183AA➝G	Exon 13	Deletion A-2184 and A-2183➝G	Frameshift
2789 + 5G➝A	Intron 14b	G-2789 + 5➝A	Splice mutation

CF Assay Components

Reagent	P/N	Quantity	Description
Buffer for EDTA Blood	T0020	1.8 mL	One purple-capped tube
Buffer for Puriﬁed DNA	T0022	1.8 mL	One red-capped tube
Human DNA, male	N/A	100 µL	One clear-capped tube containing the positive control sample.
CF PCR Reagent	T0030	136 µL	One green-capped tube containing primers, dNTPs, buffer, and AmpliTaq Gold DNA Polymerase
CF OLA Reagent v2	4310797	250 µL	One clear-capped tube containing probes and buffer
rTth DNA Ligase	T0029	14 µL	One blue-capped tube containing ligase and buffer
Product Insert v2	4322799	1	Quality Control test results for current lot of the CF PCR/OLA Module

Equipment

Thermal cycler

Microcentrifuge

Reaction Tubes

Thermal cycling program for amplifying regions of the CFTR gene.

Thermal cycling program for OLA probingthe CFTR amplicons.

PCR ampliﬁcation of ABCC7
Step	Action
1	Label a set of PCR tubes. Place the tubes in a tray and line up the tubes numerically.
2	Add 5 µL of CF PCR Reagent (P/N T0030) into each tube and close the tube.
3	Gather the samples and line up the tubes numerically.
4	Remove a 5-µL aliquot of the sample and place it into the corresponding-prelabeled tube. Close the tube.
5	Put away the original sample tubes.
6	Place the MicroAmp tray with the tubes containing 5 µL of prepared sample and 5 µL of CF PCR Reagent into the thermal cycler.
Genotyping by OLA
1	Prepare an OLA mix by combining the entire contents of the CF OLA Reagent v2 (P/N 4310797) tube with the entire contents of the rTth DNA ligase (P/N T0029) tube.
2	Mix gently and avoid foaming
3	. Quick-spin the OLA mix in the microcentrifuge to collect liquid at the bottom of the tube.
4	Pipette 10 µL of the OLA mix into each sample-containing MicroAmp tube. Follow the practices stated in "Sample Handling Protocol" on page 3–2.
5	Mix the contents of all tubes by vortexing. Quick-spin samples in the microcentrifuge to collect liquid at the bottom of the tube.
6	Place the tubes into the thermal cycler.
7	Run the OLA program
8	Microcentrifuge the samples to collect liquid at the bottom of the tube.

Data analysis

ABI PRISM 310 Balanced Peaks

CF Genotyper data with OLA peaks that are unbalanced, but still within an acceptable range. All peaks are genotyped and all alleles are labeled.

ABI PRISM 310 Mutant Homozygote

Qualities of Invalid Data

One allele is below the acceptable peak-height range and therefore has no CF Genotyper label (arrow). These results may have occurred because of inadequate amplification of the DNA.

The Cystic Fibrosis Genetic Analysis Consortium. 1994. Population variation of common cystic fibrosis mutations. Hum. Mutat. 4:167–177.

Ausubel, F.M. 1995. Short Protocols in Molecular Biology : A Compendium of Methods from Current Protocols in Molecular Biology, 3rd ed. New York:Wiley. 1 v (various pagings).

Barany, F. 1991. Genetic disease detection and DNA amplification using cloned thermostable ligase. Proc. Natl. Acad. Sci. USA 88:189–193.

Barany, F., and Gelfand, D.H. 1991. Cloning, overexpression and nucleotide sequence of a thermostable DNA ligase-encoding gene. Gene 109:1–11.

Kazazian, H.H. 1994. Population variation of common cystic fibrosis mutations: The cystic fibrosis genetic analysis consortium. Hum. Mutat. 4(3):167–177.

Kerem, B., Rommens, J.M., Buchanan, J.A., et al. 1989. Identification of the cystic fibrosis gene: genetic analysis. Science 245:1073–1080.

Kwok, S. and Higuchi, R. 1989. Avoiding false positives with PCR. Nature 339:237–238.

Mullis, K.B., and Faloona, F.A. 1987. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 155:335–350.

Riordan, J.R., Rommens, J.M., Kerem, B., et al. 1989. Identification of the cystic fibrosis gene: cloning and characterization of complimentary DNA. Science 245:1066–1073.

Rommens, J.M., Iannuzzi, M.C., Kerem, B. et al. 1989. Identification of the cystic fibrosis gene: chromosome walking and jumping. Science 245(4922):1059–1065.

Saiki, R.K., Gelfand, D.H., Stoffel, S., et al. 1988. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487–491.

Saiki, R. K., Scharf, S., Faloona, F., et al. 1985. Enzymatic amplification of b-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230:1350–1354.

Sambrook, J., Maniatis, T., and Fritsch, E.F. 1989. Molecular Cloning, A Laboratory Manual, 2nd ed. Cold Spring Harbor (NY): Cold Spring Harbor Laboratory Press. 3 v. pp. 6-34.

Tsui, L.C.1992. The spectrum of cystic fibrosis mutations. Trends Genet. 8:393–398.

U.S. Department of Health and Human Services, Centers for Disease Control and Prevention, and National Institutes of Health. 1993. Biosafety in Microbial and Biomedical Laboratories, 3rd ed. Richmond, J.Y. and McKinney, R.W., eds. Washington, D.C.: U.S. Government Printing Office. For sale by the Superintendent of Documents, U.S. Government Printing Office. Stock no. 017-040-00523-7. vi, 177 pp. U.S. Department of Health and Human Services Occupational Safety and Health Administration. 1998. Occupational Safety and Health Standards, Toxic and Hazardous Substances: Bloodborne pathogens. 29 CFR, part 1910.1030.

Welsh, M.J., Lap-Chee, T., Boat, T.F., and Beaudet, A.L.1995. Cystic Fibrosis. In: Scriver, C.R., Beaudot, A.L., Sly, W.S., and Valle, D. ed. The Metabolic Basis of Inherited Disease (Seventh Edition). pp.3799–3876.

5 Liquid phase arrays: EraGen MultiCodeÒ PLx Platform Technology

Technology for the Detection of Genomic DNA Mutations

Workshop Outline

Background

Who is EraGen

What will you learn from this workshop

Overview of Technology

Expanded Genetic Alphabet for Genetic Analysis and Detection

Platform Configuration

Chemistry

Software

Protocol, Materials and Time Requirements

Demonstration of Technology Platform - 40 min

Detection of 28 Genetic Targets in a Single Well

Instrument set-up Discussion

Software Discussion

Q & A

Data review - 10 min

Summary and Q & A - 10 min

Overview of Technology to be presented:

MultiCode PLx eliminates most of the technically challenging steps involved in multiplexed genetic analysis. EraGen now is making available the required reagents, oligonucleotides, protocols, software and training for MultiCode PLx.

MultiCode PLx employs one additional nucleobase pair constructed from the complementary nucleobases isoguanosine (iG) and 5’-Me-isocytosine (iC). These nucleobases specifically recognize each other using a unique pattern of hydrogen bonds. We chose this pair because their chemistries are well explored and no other such pair is available commercially. For example, iG and iC have been successfully employed for both molecular recognition (1-3) and for site-specific incorporation (4-6). In addition, since iG:iC recognition is "orthogonal" to the naturally occurring nucleobase pairs, a strand of DNA that contains several iC/iG components can be constructed so that it will not hybridize to natural DNA. In complex reactions where high levels of natural DNAs of known or unknown sequence exist, this orthogonal attribute allows for specific molecular recognition to take place without interference. These additional nucleobases are used in each step of the three step PLx process: PCR, extension labeling and liquid decoding. PCR primers are first designed to be target-specific and contain single iCs. After PCR, the amplicons act as labeling templates for the target specific extension (TSE) step. During that step, labels attached to 2’-deoxy-isoG triphosphate (diGTP) are incorporated site specifically into coded target specific extenders (See Figure blow).

The tags are short sequences (8 nucleotides in length) assembled using a mix of natural and non-natural bases. The tags are designed to hybridize only to their perfect complements encoded on color addressed microspheres. In the final step, decoding of the extension reactions is accomplished at room temperature by capturing the coded extenders onto the addressed microspheres and reading the reporter signal on a Luminex100 instrument. All steps are carried out in the same reaction vessel without transfers or washings.

To demonstrate the method for this demonstration, a complex target set will be analyzed. In March of 2001 the American College of Medical Genetics (ACMG), the American College of Obstetricians and Gynecologists (ACOG) and the NIH issued recommendations for laboratory standards for population-based CF carrier screening (7). The recommended core panel of CF mutations for general population CF carrier screening is composed of 25 mutations and 4 reflex tests. Three reflex tests (I506V, I507V and F508C) distinguish between CF-causing alleles and benign variants, while 5T/7T/9T also tests for mutations that are associated with CBAVD or male infertility. The PLx assay demonstrated in this workshop will test for all 25 mutations and reflex targets in a single well.

In this workshop, the attendees will learn the basics behind the technology and the steps involved in running the 2 hour system. Due to course timelines, the first two steps (PCR and TSE) will be completed prior to the beginning of the lab.

Kern D, Collins M, Fultz T, Detmer J, Hamren S, Peterkin JJ, et al. An enhanced-sensitivity branched-DNA assay for quantification of human immunodeficiency virus type 1 RNA in plasma. J Clin Microbiol 1996;34:3196-202.

Moser MJ, Marshall DJ, Grenier JK, Kieffer CD, Killeen AA, Ptacin JL, et al. Exploiting the enzymatic recognition of an unnatural base pair to develop a universal genetic analysis system. Clin Chem 2003;49:407-14.

Sherrill CB, Marshall DJ, Richmond CS, Scherrer CW, Prudent JR. Molecular Recognition on Demand. Nanotech 2003;1:52-4.

Piccirilli JA, Krauch T, Moroney SE, Benner SA. Enzymatic incorporation of a new base pair into DNA and RNA extends the genetic alphabet. Nature 1990;343:33-7.

Switzer CY, Moroney SE, Benner SA. Enzymatic recognition of the base pair between isocytidine and isoguanosine. Biochemistry 1993;32:10489-96.

Moser MJ, Prudent JR. Enzymatic repair of an expanded genetic information system. Nucleic Acids Res 2003;31:5048-53.

Grody WW, Cutting GR, Klinger KW, Richards CS, Watson MS, Desnick RJ. Laboratory standards and guidelines for population-based cystic fibrosis carrier screening. Genet Med 2001;3:149-54.

6 DHPLC

Prepared by Phil Chambers (philip.chambers@cancer.org.uk)

DHPLC practical session

Aims: Course participants should get a basic understanding of:

how DHPLC works

how to approach the analysis of a DNA fragment by DHPLC

looking at and analysing DHPLC data

the more common problems and pitfalls

Brief introduction to DHPLC

How to select a temperature for DHPLC analysis

Analysis of samples

Final discussion

Overview of the design and execution of a mutation detection project by DHPLC.

Background

Denaturing HPLC (DHPLC) (also known as temperature modulated heteroduplex analysis) exploits the differential melting properties of homo- and heteroduplex DNA in order to detect mutations.

A DNA sample is injected onto a chromatography column and binds to the column matrix via interactions mediated by the ion-pairing reagent triethylammonium acetate (TEAA). Acetonitrile disrupts this interaction and causes DNA to be eluted from the column. The absorbance at 260nm of the column eluate is measured. Elution of samples is seen as a peak of absorbance in a plot of absorbance versus time. At a non-denaturing temperature, the concentration of acetonitrile required to remove any given fragment depends on the size and sequence that fragment. Any DNA fragment, therefore, elutes at a characteristic point in a linear gradient of acetonitrile, which corresponds to a characteristic retention time on a plot of absorbance versus time.

When the temperature of the column is increased, elution takes place at progressively lower acetonitrile concentrations as the DNA fragment starts to denature. Heteroduplex DNA has different melting characteristics to homoduplex DNA and under conditions of partial denaturation has a reduced retention time on the column. At a temperature approximately 1°C below the melting temperature of the fragment, samples containing heteroduplex DNA will show a significantly different elution profile to those containing homoduplex DNA alone. Typically, a single peak from a wild type sample changes to multiple peaks from samples which contain sequence variations.

Several studies have examined the sensitivity and specificity of DHPLC and it is clear from these that DHPLC is a highly sensitive and specific technique. Four of the studies detected 100% of mutations tested, while four found that there were mutations that could not be detected under the conditions used. While it is cle

1 DNA extraction *

Introduction *

GeneCatcher™ Technology from DNA Research Innovations Ltd. *

Description *

Why is there a need for a new technology? *

What are the advantages of GeneCatcher™? *

Protocol *

Sample Preparation *

DNA Capture *

This step washes away residual contaminants *

DNA Purification *

DNA Elution *

2 Genotyping; theories and practicalities. *

Aims: *

1. What is Genotyping? *

2. How does this differ from Mutation Detection? *

3. What is a Microsatellite? *

4. What is a SNP? *

5. Why are SNP’s Important? *

6. How are these variations detected? *

7. Genotyping via microsatellite markers: *

ARMS-PCR *

Minisequencing *

Melting Curve analysis: *

OLA/PCR *

How to decide what method to use and when to use it? *

3 Polymerase chain reaction and ARMS *

PCR *

Reagents *

Primers *

PCR buffer *

dNTPs *

Thermostable polymerases *

Equipment *

PCR Machines (Thermal Cyclers) *

Hot start PCR protocol using heat-activated polymerase *

ARMS *

Principle *

Materials *

Agarose Gel Electrophoresis: *

Interpretation of Results *

References *

4 Oligonucleotide ligation assay (OLA) *

Introduction *

Overview of the Assay *

5 Liquid phase arrays: EraGen MultiCodeÒ PLx Platform Technology *

Technology for the Detection of Genomic DNA Mutations *

Workshop Outline *

Background *

Overview of Technology to be presented: *

6 DHPLC *

DHPLC practical session *

Overview of the design and execution of a mutation detection project by DHPLC. *

Background *

Theoretical predictions of melting temperature. *

Sample Preparation for DHPLC *

Sample quality *

Sample quantity *

PCR considerations *

Heteroduplex formation *

Tumour samples *

Interpretation of DHPLC data *

Identification of mutations. *

DHPLC system configuration *

Other practical considerations for DHPLC *

Troubleshooting guide *

References *

COSHH Assessment *

Control measures *

Emergency procedures *

7 Sequenom Mass Array *

Introduction *

Homogeneous MassCLEAVETM *

Forward Reactions *

Reverse Reactions *

Summary *

References *

9 Automated Fluorescent DNA Sequencing *

Applications *

Equipment and reagents *

GeneCatcher^™ Technology from DNA Research Innovations Ltd. *